Marker data

Either clone the THAPBI PICT source code repository, or decompress the latest source code release (.tar.gz file). You should find it contains a directory examples/synthetic_mycobiome/ which is for this example.

Shell scripts setup.sh and run.sh should reproduce the analysis discussed.

FASTQ data

File PRJNA305924.tsv was download from the ENA and includes the FASTQ checksums, URLs, and sample metadata (not just for the files we will be using, but additional Illumina MiSeq runs, and Ion Torrent data too).

Script setup.sh will download the raw FASTQ files for two of the Illumina MiSeq runs described in Palmer et al. (2018) from https://www.ebi.ac.uk/ena/data/view/PRJNA305924

It will download 42 raw FASTQ files (21 pairs), taking about 4.8 GB on disk.

If you have the md5sum tool installed (standard on Linux), verify the FASTQ files downloaded correctly:

$ cd ..
$ md5sum -c MD5SUM.txt
...
$ cd ..

There is no need to decompress the files.

Amplicon primers & reference sequences

A region of ITS2 was amplified using the fITS7/ITS4 primer pair (GTGARTCATCGAATCTTTG and TCCTCCGCTTATTGATATGC) with an average product length of 264bp using public fungal sequences.

The file references.fasta we provide is based on amptk_mock2.fa and amptk_mock3.fa from the authors’ GitHub repository <https://github.com/nextgenusfs/amptk/tree/master/amptk/DB>, but formatted suitable for direct import into our tool with primer-trimmed sequences.

Additional file environment.fasta contains selected close matches to sequences from the environmental samples in the NCBI found with BLASTN against the NT database.

Metadata

File metadata.tsv is based on the ENA metadata and the paper text. It has four columns:

  1. run_accession, assigned by the public archive, e.g. “SRR7109326”

  2. library_name, with sequencing run as a prefix, e.g. “m6-stds” or “m6-301-1”

  3. sample_alias, as used in the paper, e.g. “BioMockStds” or “301-1”

  4. group, human readable sample type, e.g. “Biological Mock” or “Environment”

  5. read_count, the number of read pairs in the FASTQ files

When calling THAPBI PICT, the meta data commands are given as follows:

$ thapbi_pict ... -t metadata.tsv -x 1 -c 3,4

Argument -t metadata.tsv says to use this file for the metadata.

Argument -c 3,4 says which columns to display and sort by. This means sample alias, then group.

Argument -x 1 (default, so not needed) indicates the filename stem can be found in column 1, run accession.

Other files

Provided files BioMockStds.known.tsv, BioMock.known.tsv, and SynMock.known.tsv list the expected 25 species, 22 species, and 12 synthetic controls expected in the mock samples. Folder expected/ is created linking accession names to the appropriate species for assessing the classifier performance.

Sub-folder intermediate/ITS2/ is used for intermediate files, in general there is a sub-folder for each primer-pair.