Examining the database
This example follows on from Different primers, and assumes
you have used thapbi_pict import
with the provided FASTA file
(based on Supplementary Table 3 in Redekar et al. 2019), and created a
THAPBI PICT database named Redekar_et_al_2019_sup_table_3.sqlite
.
As the extension might suggest, this is an Sqlite v3 database, and can be examined directly at the command line if you are very curious. However, we will briefly review the provided commands within THAPBI PICT for checking a database.
Database export
The thapbi_pict dump
command is intended for database export and/or
answering simple queries without needing to use SQL to query the database.
It defaults to giving plain text tab separated tables, but FASTA is also
supported:
$ thapbi_pict dump -h
...
By default it outputs all the sequences, but you can do simple taxonomic filtering at genus or species level, for example:
$ thapbi_pict dump -d Redekar_et_al_2019_sup_table_3.sqlite \
-g Phytophthora -s fallax -o P_fallax.tsv
Wrote 5 txt format entries to 'P_fallax.tsv'
$ cut -c 1-84 P_fallax.tsv
<SEE TABLE BELOW>
This gives a short table, with the sequence truncated for display:
#Marker |
Identifier |
Genus |
Species |
TaxID |
MD5 |
Sequence |
---|---|---|---|---|---|---|
ITS1-long |
DQ297398.1 |
Phytophthora |
fallax |
360399 |
693cf88b7f57bcc7a3532a6b7ff0268a |
CCA |
ITS1-long |
HQ261557.1 |
Phytophthora |
fallax |
360399 |
693cf88b7f57bcc7a3532a6b7ff0268a |
CCA |
ITS1-long |
HQ261558.1 |
Phytophthora |
fallax |
360399 |
693cf88b7f57bcc7a3532a6b7ff0268a |
CCA |
ITS1-long |
HQ261559.1 |
Phytophthora |
fallax |
360399 |
693cf88b7f57bcc7a3532a6b7ff0268a |
CCA |
ITS1-long |
DQ297392.1 |
Phytophthora |
fallax |
360399 |
da7ff4ae11bdb6cc2b8c2aea3937481f |
CCA |
The final columns give the amplicon marker sequence and its MD5 checksum.
Adding -m
or --minimal
to the command gives instead:
$ thapbi_pict dump -d Redekar_et_al_2019_sup_table_3.sqlite \
-g Phytophthora -s fallax -o P_fallax.tsv -m
Wrote 2 txt format entries to 'P_fallax.tsv'
$ cut -c 1-56 P_fallax.tsv
<SEE TABLE BELOW>
Now the table only has one data row per unique marker sequence, again showing this with the sequence truncated:
#MD5 |
Species |
Sequence |
---|---|---|
693cf88b7f57bcc7a3532a6b7ff0268a |
Phytophthora fallax |
CCA |
da7ff4ae11bdb6cc2b8c2aea3937481f |
Phytophthora fallax |
CCA |
Alternatively, we can ask for FASTA output:
$ thapbi_pict dump -d Redekar_et_al_2019_sup_table_3.sqlite \
-g Phytophthora -s fallax -f fasta -o P_fallax.fasta
Wrote 2 fasta format entries to 'P_fallax.fasta'
This produces a short FASTA file as follows (with line wrapping added for display):
$ cat P_fallax.fasta
>DQ297398.1 Phytophthora fallax taxid=360399;HQ261557.1 Phytophthora fallax
taxid=360399;HQ261558.1 Phytophthora fallax taxid=360399;HQ261559.1 Phytophthora
fallax taxid=360399
CCACACCTAAAAAAATTCCACGTGAACTGTATTGTCAACCAAATTCGGGGATTCCTTGCTAGCGTGCCTTCGGGCGTGCC
GGTAGGTTGAGACCCATCAAACGAAAACATCGGCTGAAAGGTCGGAGCCAGTAGTTACCTTTGTAAACCCTTTACTAAAT
ACTGAAAAACTGTGGGGACGAAAGTCCTTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTC
>DQ297392.1 Phytophthora fallax taxid=360399
CCACACCTTAAAAAATTCCACGTGAACTGTATTGTCAACCAAATTCGGGGATTCCTTGCTAGCGTGCCTTCGGGCGTGCC
GGTAGGTTGAGACCCATCAAACGAAAACATCGGCTGAAAGGTCGGAGCCAGTAGTTACCTTTGTAAACCCTTTACTAAAT
ACTGAAAAACTGTGGGGACGAAAGTCCTTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTC
To be clear, each FASTA record is written as two potentially very long lines.
The first title line consists of the FASTA new record >
marker and then
four semi-colon separated accessions with species. The sequence shared by those
four entries is given on the second line (without line breaks as markers tend
not to be overly long, and it facilitates command line analysis/debugging).
Using the optional -m
or --minimal
switch changes the FASTA output to:
$ thapbi_pict dump -d Redekar_et_al_2019_sup_table_3.sqlite \
-g Phytophthora -s fallax -f fasta -o P_fallax_minimal.fasta -m
Wrote 2 fasta format entries to 'P_fallax_minimal.fasta'
$ cat P_fallax_minimal.fasta
>693cf88b7f57bcc7a3532a6b7ff0268a Phytophthora fallax
CCACACCTAAAAAAATTCCACGTGAACTGTATTGTCAACCAAATTCGGGGATTCCTTGCTAGCGTGCCTTCGGGCGTGCC
GGTAGGTTGAGACCCATCAAACGAAAACATCGGCTGAAAGGTCGGAGCCAGTAGTTACCTTTGTAAACCCTTTACTAAAT
ACTGAAAAACTGTGGGGACGAAAGTCCTTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTC
>da7ff4ae11bdb6cc2b8c2aea3937481f Phytophthora fallax
CCACACCTTAAAAAATTCCACGTGAACTGTATTGTCAACCAAATTCGGGGATTCCTTGCTAGCGTGCCTTCGGGCGTGCC
GGTAGGTTGAGACCCATCAAACGAAAACATCGGCTGAAAGGTCGGAGCCAGTAGTTACCTTTGTAAACCCTTTACTAAAT
ACTGAAAAACTGTGGGGACGAAAGTCCTTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTC
This discards the original accessions and instead uses >
, MD5 checksum,
space, semi-colon separated list of taxonomic assignments, new line, sequence,
new line. Again, there is deliberately no sequence line wrapping in the file
itself.
Edit graph
In the worked example with the default database, we introduced the
edit-graph
command for use with CytoScape to examine the sequence space of
the samples. It can also be run on a database alone provided you include the
-k
or --marker
switch:
$ thapbi_pict edit-graph -k ITS1-long \
-d Redekar_et_al_2019_sup_table_3.sqlite \
-o Redekar_et_al_2019_sup_table_3.xgmml
Loaded 838 unique ITS1-long sequences from DB.
Computed Levenshtein edit distances.
Will draw 533 nodes with at least one edge (305 are isolated sequences).
Of the 838 unique sequences in the database, just over three hundred are isolated sequences (over 3bp edits away from anything else). The remaining five hundred plus give us an interesting edit distance graph.
Opening this in CytoScape the first thing that struck me was the largest two components are both for Pythium regulare - suggesting if these are truly all from one species that it has at least two distinct ITS1 markers in the genome?
Another use of this view would be to consider the genus conflicts reported
by the thapbi_pict conflicts
command - most of the handful of Lagenidium
and Brevilegnia nodes are isolated.