Community Edit Graphs
The sequence Edit Graph is very useful for understanding what came off the sequencer - although you may need to play with the thresholds to find a sweet spot for hiding the noise.
My main conclusion from the figures below is that the THAPBI PICT default
onebp classifier is reasonable for these fungal communities markers.
However, for the ITS1 marker Fusarium needs closer examination, and there
should be even more database entries for Rhizomucor irregularis. You would
of course also need to expand the database beyond the 19 species in the mock
community to use these ITS1 or ITS2 fungal markers more generally.
Image generation
If you have loaded an XGMML network file from THAPBI PICT into Cytoscape, you
can interactively select nodes based on the Max-sample-abundance attribute
and hide or remove them. This is helpful for exploring what minimum threshold
to use for drawing a clear edit graph, but this does not update the
Sample-count and node sizes which are based on it.
For that you can re-run thapbi_pict edit-graph with the higher sample
level minimum abundance setting (-a or --abundance). You do not need
to regenerate the intermediate per-sample FASTA files unless you want to use a
lower threshold.
The following figures are from the example script run.sh which called
thapbi_pict edit-graph with -a 75, meaning a unique sequence had to be
in a sample from at least 75 reads to be considered. Using a lower value gives
a much noiser picture (see the Halo effect discussed earlier).
Additionally this used -k (or --marker) to force including all of the
database sequences (dark red nodes), as some did not appear in the samples
(shown as the smallest dark red dots, typically the bottom row of the image).
And, it used -m - (or --method -) to deliberately not label the nodes
with the classifier output - only the data entries get a species label.
The XGMML files were loaded, automatically laid out using the “Perfuse Force Directed Layout” menu, manually adjusted to give a reasonably consistent node placement for comparison between the figures, and then images exported in SVG format (other formats are also supported including PDF and PNG).
Amplicon library one - ITS1
Starting with amplicon library one, where the BITS/B58S3 primers were used for a short fragment of ITS1.
This is from file AL1.BITS_B58S3.edit-graph.a75.xgmml created by
run.sh.
The dark red nodes represent sequences in the database - given how this database was constructed to match the mock community, we would hope to see all the database entries represented in the samples. Some are missing at this abundance threshold (four bottom row entries Saccharomyces cerevisiae, Ustilago maydis, Rhizomucor miehei and Chytriomyces hyalinus, plus the four Rhizomucor irregularis entries shown across the middle.
The large red nodes are the well represented community members, starting with Naganishia albida shown top left, which has four different 1bp variants some of which are large meaning they appear in many samples - you can see the sample counts in you load the XGMML file for this graph in Cytoscape. These are common enough to suggest they could be alternative versions of the ITS1 region in the genomes of these community members?
The (sometimes large) grey nodes not connected to a red node represent unwanted reads, likely contaminations discussed later.
In general each species is represented by a single connected component. The
exceptions are Rhizomucor irregularis (multiple distantly related entries)
and the Fusarium. The expected sequence for Fusarium verticillioides was
not seen at all, however there are a great many copies one base away from
the expected Fusarium oxysporum sequence (abbreviated MD5 checksum
bb28f2, in full bb28f2b57f8fddefe6e7b5d01eca8aea). Is this perhaps
coming from the Fusarium verticillioides strain?
Amplicon library two - ITS1
First, analysed using the same BITS/B58S3 primers as for ITS1 as in amplicon library one - the unique sequence MD5 checksums overlap with those seen in amplicon one:
This is from file AL2.BITS_B58S3.edit-graph.a75.xgmml created by
run.sh.
Broadly the same as from amplicon library one, but notice the
presence/absence patterns are different. Also there are more variants of the
bb28f2 Fusarium, and a pair of unexpected grey nodes 3bp apart
(e055cb and ee5482, middle left, discussed below).
Now, using the actual primer pair, ITS1f/ITS2, which give a longer ITS1 fragment. Note that the sequences are extended so the checksums are different to those in the preceding images, but again broadly the same picture as the two images above:
This is from file AL2.ITS1f_ITS2.edit-graph.a75.xgmml created by
run.sh.
The curious large grey node one edit away from Fusarium oxysporum has
abbreviated MD5 checksum f1b689, or in full
f1b689ef7d0db7b0d303e9c9206ee5ad (given in the XGMML node attributes).
Referring back to the intermediate FASTA files or the read report, this does
indeed represent the extended version of bb28f2b57f8fddefe6e7b5d01eca8aea
with the first primer set:
>bb28f2b57f8fddefe6e7b5d01eca8aea
ATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCAATTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACG
GGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATCAA
>f1b689ef7d0db7b0d303e9c9206ee5ad
AAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATA
CCAATTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTAT
ATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTG
Using an NCBI BLAST search, this exact sequence has been published from over a dozen different Fusarium species including Fusarium oxysporum, but not at the time of writing from Fusarium verticillioides.
The small pair of grey nodes 3bp apart (long diagonal line, middle left),
57b06d and 05007e, are the extended equivalents of e055cb and
ee5482 shown in the same place in the previous image. They seem to match
glomeromycetes, perhaps from the Rhizophagus in the mock community.
Amplicon library two - ITS2
Finally, amplicon library two using the ITS3-KYO and ITS4-KYO3 primers for ITS2:
This is from file AL2.ITS3-KYO2_ITS4-KYO3.edit-graph.a75.xgmml
created by run.sh.
Some more noteworthy changes to presence/absence, including much more Saccharomyces cerevisiae (still drawn bottom left). Also there are no unexpected grey nodes, and perhaps most interestingly from a species classification point of view, now the three Fusarium species fall into separate connected components.