Marker data

Either clone the THAPBI PICT source code repository, or decompress the latest source code release (.tar.gz file). You should find it contains a directory examples/great_lakes/ which is for this example.

Shell scripts setup.sh and run.sh should reproduce the analysis discussed.

Subdirectories MOL16S/ and SPH16S/ are used for the different amplicons (with different primer settings and reference databases).

FASTQ data

File PRJNA379165.tsv was download from the ENA and includes the FASTQ checksums, URLs, and sample metadata. Derived file metadata.tsv contains report-ready metadata about the samples (see below).

Script setup.sh will download the raw FASTQ files for Klymus et al. (2017) from https://www.ebi.ac.uk/ena/data/view/PRJNA379165

It will download 36 raw FASTQ files (18 pairs), taking 1.8GB on disk.

If you have the md5sum tool installed (standard on Linux), verify the FASTQ files downloaded correctly:

$ cd raw_data/
$ md5sum -c MD5SUM.txt
...
$ cd ../

There is no need to decompress the files.

Amplicon primers & reference sequences

The MOL16S amplicon targeted a short fragment of the mtDNA 16S RNA gene using degenerate primer pair MOL16S_F/MOL16S_R (RRWRGACRAGAAGACCCT and ARTCCAACATCGAGGT).

The SPH16S amplicon targeted sphaeriid mussel species where it amplified an overlapping slightly downstream region of the mtDNA 16S RNA gene using non-degenerate primers SPH16S_F/SPH16S_R (TAGGGGAAGGTATGAATGGTTTG and ACATCGAGGTCGCAACC).

This means we need to run THAPBI PICT twice (once for each primer pair, against a different marker database each time).

Metadata

The provided file metadata.tsv is based on metadata in the ENA, split into separate columns for reporting. It has five columns:

  1. Run accession, e.g. “SRR5534972”

  2. Library name, e.g. “SC3PRO2”

  3. Sample title, e.g. “Mock Community 2 MOL16S with Fish Block Primer”

  4. Marker, “MOL16S” or “SPH16S”

  5. Group, “Mock Community”, “Aquarium”, “River” or “Control”

When calling THAPBI PICT, the meta data commands are given as follows:

$ thapbi_pict ... -t metadata.tsv -x 1 -c 4,5,3,2

Argument -t metadata.tsv says to use this file for the metadata.

Argument -c 4,5,3,2 says which columns to display and sort by. This means Marker, Group, Sample Title, Library name. This splits up the samples first by the expected marker, and then the group.

Argument -x 1 the filename stems can be found in that column one.

Other files

Files MOL16S.fasta and SPH16S.fasta are for building reference databases. These were constructed from the accessions in the paper listed in Table 1, Table 8, Supplementary Table 1, Supplementary Table 3, and some additional accessions for the mock community. The sequences were primer trimmed using cutadapt (requiring both the left and right primer to be present), and the description given cut to just species level (discarding strain or isolate information).